Starting November last year, I am a PhD Researcher with the Garden’s Science team. My core project uses the Garden’s honey bees to investigate foraging preferences, or what plants the bees are using.
This work makes up the beginnings of my project with the Garden and Bangor University, funded by KESS. The Garden made Wales the first nation in the world to DNA barcode every native flowering plant and it’s this DNA barcoding expertise that is being used in my work.
Declines in pollinators
There is huge concern over increased rates of honey bee colony loss, with a 25% reduction in honey bee colonies in Europe between 1985 and 2005 and a 59% loss of colonies in North America between 1947 and 2005.
The interacting effects of land-use change, the loss and fragmentation of habitat, intensive farming with increased pesticide application, diversity of forage, pests and diseases, and climate change are all potentially contributing to poor honey bee health and the loss of colonies.
Honey bee foraging
In order to understand these declines and provide advice to protect against them, we’re interested in looking at the honey bee diet. As part of this we’ve been studying the honey from our hives throughout the season, using DNA barcoding to find out the plants that make up the honey and comparing this to what is in flower in the Garden. With this information we can start to discuss the choices the honey bees are making with the plants they are using.
Honey and DNA barcoding
How do we find out the plants that make up the honey? By extracting the pollen from the honey, we can use DNA barcoding to identify the plant it came from, using short regions of DNA unique to a species, or DNA barcodes. The sequence of a DNA barcode looks like this (although longer):
AAATGTTGGATTTAAGGCTGGTGTAAAAGATTATAAATTAACTTATTATACTCCGGACTATGAAACCAAGGATA
DNA is made up from just four bases, represented by the letters A, T, C and G. It’s the differences between the order of these letters that allows us to identify their source, and therefore what plants our bees were visiting to make the honey in our hives.
Each DNA barcode stored in the Barcode of Life Database (BOLD) is available to use and view by everyone, including other researchers. It includes the DNA sequence but also information on the plant individual the DNA came from.
Surveying the Garden
DNA barcoding our honey gives us the plants the bees are using but what about knowing the plants that were in flower and available to the bees? That’s where our survey comes in. Once a month, to match our honey sampling, we go out and survey all the plants in flower in the Garden. If that sounds like a daunting task (especially in the height of summer with beautiful beds filled with variety) you would be correct!
Luckily, we have the support of the fantastic group of conservation volunteers, who meet each Tuesday at the Garden. In our survey week, we can count on them to help us go out and record, contributing to our data set and research. Without them, I’d be spending all of my time outside just trying to get the plant survey finished!
Continuing work
Last year, we went out each month from April to September, sampled honey from each of our hives and recorded everything in flower. At the moment, I’ve finished my lab work on those honey samples, with them now all in the sequencing machine ready to be processed. Once the samples are sequenced we can start analysing the millions of DNA sequences that will be returned to us. This year we want to do the same again, which will give us the chance to make comparisons between two years of foraging data.
Knowledge Economy Skills Scholarships (KESS) is a pan-Wales higher level skills initiative led by Bangor University on behalf of the HE sector in Wales. It is part funded by the Welsh Government’s European Social Fund (ESF) convergence programme for West Wales and the Valleys.